Alpha ADN: Custom DNA synthesis - oligonucleotides, aka oligos, primers

Version française ici

News alert!

Primers, probe and positive control for the Omicron variant of SARS-CoV-2 (Covid-19 virus), developed by the Joint Research Centre (JRC) of the European Commission (https://ec.europa.eu/jrc/en/news/efficient-tracing-omicron-new-pcr-test) :

Name	Sequence (5’ to 3’); in green color : mutations specific to the Omicron	Size (number of bases)
Omt-F	AACAAACCTTGTAATGGTGTTGC	23
Omt-R	TGCTGGTGCATGTAGAAGTTC	21
Omt-P	FAM-GATCATATAGTTTCCGACCCACTTATGGTGTTGGTC-BHQ1	36
Amplicon (positive control)	AACAAACCTTGTAATGGTGTTGCAGGTTTTAATTGTTACTTTCCTTTACGATCATATAGTTTCCGACCCACTTATGGTGTTGGTCACCAACCATACAGAGTAGTAGTACTTTCTTTTGAACTTCTACATGCACCAGCA	138

Here is a new reverse primer for the RNase P gene as a replacement for the faulty CDC RNase P reverse primer causing false positives and "contamination" problems in Covid-19 testing:

Faulty CDC RNase P reverse primer: GAGCGGCTGTCTCCACAAGT

New correct primer from Rob Dekker and co-authors at the University of Amsterdam in the Netherlands:

RNase P (UVA)-R: GATAGCAACAACTGAATAGCCAAGGT

We would like to strongly recommend to everyone replacing the faulty CDC primer with the above primer from the article of Rob Dekker et al. (link to the full-length article http://genseq-h0.science.uva.nl/download/Overhauling_a_faulty_CDC_SARS-CoV-2_rRT-PCR_control-UvA-vfin.pdf ). The article also explains how and why exactly the CDC primer is faulty.

NEW: COVID-19 primers and probes used in different counties worldwide, according to the WHO (the World Health Organization)
Primer/probe name	DNA sequence (5' to 3')	recommended primer/probe final concentration (nM = nmol/liter)	Alpha DNA (Alpha ADN) synthetic DNA primers and probes
Primer/probe name	DNA sequence (5' to 3')		catalog number	synthesis scale	guaranteed minimum DNA quantity (desalted oligonucleotides)	Number of reactions per delivered product, 25 µl PCR reaction volume)	Price in USD
Primers and probes allowed by the CDC (Atlanta, Georgia) for use in the USA:
2019-nCoV_Nl-F	GACCCCAAAATCAGCGAAAT	500 nM	U1	200 nmol	50 nmol /10 OD	>4000	7.80
2019-nCoV_Nl-R	TCTGGTTACTGCCAGTTGAATCTG	500 nM	U2	200 nmol	50 nmol /10 OD	>4000	9.36
2019-nCoV_Nl-P	FAM-ACCCCGCATTACGTTTGGTGGACC-BHQ1	125 nM	U3	200 nmol	50 nmol /10 OD	>16000	88.36
2019-nCoV_N2-F	TTACAAACATTGGCCGCAAA	500 nM	U4	200 nmol	50 nmol /10 OD	>4000	7.80
2019-nCoV_N2-R	GCGCGACATTCCGAAGAA	500 nM	U5	200 nmol	50 nmol /10 OD	>4000	7.02
2019-nCoV_N2-P	FAM-ACAATTTGCCCCCAGCGCTTCAG-BHQ1	125 nM	U6	200 nmol	50 nmol /10 OD	>16000	87.97
2019-nCoV_N3-F	GGGAGCCTTGAATACACCAAAA	500 nM	U7	200 nmol	50 nmol /10 OD	>4000	8.58
2019-nCoV_N3-R	TGTAGCACGATTGCAGCATTG	500 nM	U8	200 nmol	50 nmol /10 OD	>4000	8.19
2019-nCoV_N3-P	FAM-AYCACATTGGCACCCGCAATCCTG-BHQ1	125 nM	U9	200 nmol	50 nmol /10 OD	>16000	88.36
RP-F RNAse P Forward	AGATTTGGACCTGCGAGCG	500 nM	U10	200 nmol	50 nmol /10 OD	>4000	7.41
RP-R RNAse P Reverse	GAGCGGCTGTCTCCACAAGT (please avoid ordering this faulty CDC primer and replace it with the primer in the news alert above) RNase P (UVA)-R: GATAGCAACAACTGAATAGCCAAGGT	500 nM	U11	200 nmol	50 nmol /10 OD	>4000	7.80
RP-P RNAse P	FAM-TTCTGACCTGAAGGCTCTGCGCG-BHQ1	125 nM	U12	200 nmol	50 nmol /10 OD	>16000	87.97

Primers and probes used in mainland China (新型冠状病毒核酸检测引物和探针序列) :
Target 1（ORF1ab）:
正向引物 ORF1ab（F）：	CCCTGTGGGTTTTACACTTAA	500 nM	C1	200 nmol	50 nmol /10 OD	>4000	8.19
反向引物 ORF1ab（R）：	ACGATTGTGCATCAGCTGA	500 nM	C2	200 nmol	50 nmol /10 OD	>4000	7.41
荧光探针 ORF1ab（P）：	FAM-CCGTCTGCGGTATGTGGAAAGGTTATGG-BHQ1	150 nM	C3	200 nmol	50 nmol /10 OD	>13333	89.92
Target 2（N）:
正向引物 N（F）：	GGGGAACTTCTCCTGCTAGAAT	500 nM	C4	200 nmol	50 nmol /10 OD	>4000	8.58
反向引物 N（R）：	CAGACATTTTGCTCTCAAGCTG	500 nM	C5	200 nmol	50 nmol /10 OD	>4000	8.58
荧光探针 N（P）：	FAM-TTGCTGCTGCTTGACAGATT-BHQ1	150 nM	C6	200 nmol	50 nmol /10 OD	>13333	86.8

Primers and probes used in the Hong Kong Special Administrative Region of China:
Assay 1 (Target: ORF1b-nsp14)
HKU-ORF1b-nsp14F	TGGGGYTTTACRGGTAACCT	500 nM	H1	200 nmol	50 nmol /10 OD	>4000	7.80
HKU- ORF1b-nsp14R	AACRCGCTTAACAAAGCACTC	500 nM	H2	200 nmol	50 nmol /10 OD	>4000	8.19
(HKU-ORF1b-nsp141P	FAM-TAGTTGTGATGCWATCATGACTAG-BHQ1	250 nM	H3	200 nmol	50 nmol /10 OD	>8000	88.36
Assay 2 (Target: N)
HKU-NF	TAATCAGACAAGGAACTGATTA	500 nM	H4	200 nmol	50 nmol /10 OD	>4000	8.58
HKU-NR	CGAAGGTGTGACTTCCATG	500 nM	H5	200 nmol	50 nmol /10 OD	>4000	7.41
HKU-NP	FAM-GCAAATTGTGCAATTTGCGG-BHQ1	250 nM	H6	200 nmol	50 nmol /10 OD	>8000	86.80

Primers and probes used in Japan:
1) ORF1a set (regular PCR, not real-time PCR)
NIID_WH-1_F501 (S)	TTCGGATGCTCGAACTGCACC	500 nM	J1	200 nmol	50 nmol /10 OD	>4000	8.19
NIID_WH-1_R913 (AS)	CTTTACCAGCACGTGCTAGAAGG	500 nM	J2	200 nmol	50 nmol /10 OD	>4000	8.97
NIID_WH-1_F509 (S)	CTCGAACTGCACCTCATGG	500 nM	J3	200 nmol	50 nmol /10 OD	>4000	7.41
NIID_WH-1_R854 (AS)	CAGAAGTTGTTATCGACATAGC	500 nM	J4	200 nmol	50 nmol /10 OD	>4000	8.58
NIID_WH-1_Seq_F519 (S)	ACCTCATGGTCATGTTATGG	500 nM	J5	200 nmol	50 nmol /10 OD	>4000	7.80
NIID_WH-1_Seq_R840 (AS)	GACATAGCGAGTGTATGCC	500 nM	J6	200 nmol	50 nmol /10 OD	>4000	7.41
2) S set (regular PCR, not real-time PCR)
WuhanCoV-spk1-f (S)	TTGGCAAAATTCAAGACTCACTTT	500 nM	J7	200 nmol	50 nmol /10 OD	>4000	9.36
WuhanCoV-spk2-r (AS)	TGTGGTTCATAAAAATTCCTTTGTG	500 nM	J8	200 nmol	50 nmol /10 OD	>4000	9.75
NIID_WH-1_F24381 (S)	TCAAGACTCACTTTCTTCCAC	500 nM	J9	200 nmol	50 nmol /10 OD	>4000	8.19
NIID_WH-1_R24873 (AS)	ATTTGAAACAAAGACACCTTCAC	500 nM	J10	200 nmol	50 nmol /10 OD	>4000	8.97
NIID_WH-1_Seq_F24383 (S)	AAGACTCACTTTCTTCCACAG	500 nM	J11	200 nmol	50 nmol /10 OD	>4000	8.19
NIID_WH-1_Seq_R24865 (AS)	CAAAGACACCTTCACGAGG	500 nM	J12	200 nmol	50 nmol /10 OD	>4000	7.41
3) Primers and probes for real-time RT-PCR
NIID_2019-nCOV_N_F2	AAATTTTGGGGACCAGGAAC	500 nM	J13	200 nmol	50 nmol /10 OD	>4000	7.80
NIID_2019-nCOV_N_R2	TGGCAGCTGTGTAGGTCAAC	700 nM	J14	200 nmol	50 nmol /10 OD	>2857	7.80
NIID_2019-nCOV_N_P2	FAM-ATGTCGCGCATTGGCATGGA-BHQ	200 nM	J15	200 nmol	50 nmol /10 OD	>10000	86.41

Primers and probes used in Germany:
Assay 1 (RdRRP)
RdRP_SARSr-F2	GTGARATGGTCATGTGTGGCGG	600 nM	G1	200 nmol	50 nmol /10 OD	>3333	8.58
RdRP_SARSr-R1	CARATGTTAAASACACTATTAGCATA	800 nM	G2	200 nmol	50 nmol /10 OD	>2500	10.14
RdRP_SARSr-P2	FAM-CAGGTGGAACCTCATCAGGAGATGC-BHQ1	100 nM	G3	200 nmol	50 nmol /10 OD	>20000	88.75
(the above probe is specific for 2019-nCoV, will not detect SARS-CoV)
RdRP_SARSr-P1	FAM-CCAGGTGGWACRTCATCMGGTGATGC-BHQ1	100 nM	G4	200 nmol	50 nmol /10 OD	>20000	89.14
(the above probe is a Pan-Sarbeco probe, will detect 2019-nCoV, SARS-CoV and bat-SARS-related CoVs)
Assay 2 (E gene) (this set is identical to the one used in France, as is the final concentration of the primers and probes)
E_Sarbeco_F1	ACAGGTACGTTAATAGTTAATAGCGT	400 nM	G5	200 nmol	50 nmol /10 OD	>5000	10.14
E_Sarbeco_R2	ATATTGCAGCAGTACGCACACA	400 nM	G6	200 nmol	50 nmol /10 OD	>5000	8.58
E_Sarbeco_P1	FAM-ACACTAGCCATCCTTACTGCGCTTCG-BHQ1	200 nM	G7	200 nmol	50 nmol /10 OD	>10000	89.14
Assay 3 (N gene), see https://www.ncbi.nlm.nih.gov/pmc/articles/PMC6988269/
N_Sarbeco_F	CACATTGGCACCCGCAATC	600 nM	G8	200 nmol	50 nmol /10 OD	>3333	7.41
N_Sarbeco_R	GAGGAACGAGAAGAGGCTTG	800 nM	G9	200 nmol	50 nmol /10 OD	>2500	7.80
N_Sarbeco_P	FAM-ACTTCCTCAAGGAACAACATTGCCA-BHQ1	200 nM	G10	200 nmol	50 nmol /10 OD	>10000	88.75

Primers and probes used in Thailand:
WH-NIC N-F	CGTTTGGTGGACCCTCAGAT	1000 nM	T1	200 nmol	50 nmol /10 OD	>2000	7.80
(the above primer partially overlaps with the CDC probe 2019-nCoV_Nl-P)
WH-NIC N-R	CCCCACTGCGTTCTCCATT	1000 nM	T2	200 nmol	50 nmol /10 OD	>2000	7.41
WH-NIC N-P	FAM-CAACTGGCAGTAACCA-BQH1	250 nM	T3	200 nmol	50 nmol /10 OD	>8000	85.24

Primers and probes used in France (Insitut Pasteur, Paris):
RdRp gene / nCoV_IP2
nCoV_IP2-12669Fw	ATGAGCTTAGTCCTGTTG	400 nM	F1	200 nmol	50 nmol /10 OD	>5000	7.02
nCoV_IP2-12759Rv	CTCCCTTTGTTGTGTTGT	400nM	F2	200 nmol	50 nmol /10 OD	>5000	7.02
nCoV_IP2-12696bProbe	HEX-AGATGTCTTGTGCTGCCGGTA-BHQ1	160 nM	F3	200 nmol	50 nmol /10 OD	>12500	87.19
RdRp gene / nCoV_IP4
nCoV_IP4-14059Fw	GGTAACTGGTATGATTTCG	400 nM	F4	200 nmol	50 nmol /10 OD	>5000	7.41
nCoV_IP4-14146Rv	CTGGTCAAGGTTAATATAGG	400 nM	F5	200 nmol	50 nmol /10 OD	>5000	7.80
nCoV_IP4-14084Probe(+)	FAM-TCATACAAACCACGCCAGG-BHQ1	160 nM	F6	200 nmol	50 nmol /10 OD	>12500	86.41
E gene/E_Sarbeco (this set is identical to the one used in Germany, as is the final concentration of the primers and probes)
E_Sarbeco_F1	ACAGGTACGTTAATAGTTAATAGCGT	400 nM	F7	200 nmol	50 nmol /10 OD	>5000	10.14
E_Sarbeco_R2	ATATTGCAGCAGTACGCACACA	400 nM	F8	200 nmol	50 nmol /10 OD	>5000	8.58
E_Sarbeco_P1	FAM-ACACTAGCCATCCTTACTGCGCTTCG-BHQ1	200 nM	F9	200 nmol	50 nmol /10 OD	>10000	89.14

Custom DNA Oligonucleotide Synthesis

Current Oligonucleotide Prices (desalted oligos, free desalting included):

Synthesis scale	Oligo length	Guaranteed minimum yield*	Price per base (USD)	Price per base (CAD)**	Extra cost (USD/CAD)
25 nmole	10-65 bases	2 OD or 5 nmole	0.18	0.18	0.00
100 nmole	Any (oligos shorter than 10 bases are charged as 10-mers)	6 OD or 25 nmole	0.29	0.29	0.00
200 nmole	Any (oligos shorter than 10 bases are charged as 10-mers)	12 OD or 50 nmole	0.39	0.39	0.00
1000 nmole (1 µmole)	Any (oligos shorter than 10 bases are charged as 10-mers)	50 OD or 500 nmole	0.79	0.79	0.00
15000 nmole (15 µmole)	Any	600 OD or 5000 nmole (3500 nmole for oligos < 5 bases)	6.50	6.50	30.00 per oligo

*The relations between different units for oligo quantification are calculated by a computer, but as an approximation for a 20-base long oligo, 50 nmole equals approx. 10 OD units (at 260 nm wavelength) or 300 micrograms. Example: An 8-mer oligo CTACTAGC is ordered at the 100 nmole scale; the final DNA quantity delivered to the customer is 71 nmole (71000 pmole), which for this particular oligo equals 168 micrograms and 5.3 OD units. Our guaranteed minimum is either 6 OD or 25 nmole. The delivered product does not have 6 OD (it is only 5.3 OD units), but at 71 nmole, it is almost three times more than the guaranteed 25 nmole; therefore, the actual yield is considered sufficient (higher than the guaranteed minimum). The above table is for desalted oligos without additional purifications or modifications. The guaranteed minimum for oligos with additional purification is usually 40% of the guaranteed minimum for desalted oligos. Oligos with additional modifications may yield less than the guaranteed minimum for oligos without

modifications.

**The prices in Canadian dollars are valid only for customers from Canada, and are subject to government sales taxes (GST, HST, QST). The taxes are extra (not included in the above prices).

Fluorescent oligos: Most of our fluorescent dyes are now only 29 USD / 29 CAD per modification, either 5' or 3' label, 100 nmole or 200 nmole scale: FAM, HEX, TET, VIC-replacement, NED-replacement, PET-replacement, Texas Red, JOE, Cy3, Cy3.5, Cy5, Cy5.5, and many more, click here for details on the single-label probes. For dual-label probes (real-time PCR probes, qPCR probes, TaqMan probes) please click here. Our prices for the dual-label probes are among the lowest in the world, starting from less than 70 dollars per probe.

Add your country or U.S. state to the list of our customers, and get 25% off your first order(s)! Click here for details.

More than 99% of all orders are shipped within 24 hours (excluding weekends and holidays).