Custom DNA (left)Alpha ADN, toll-free fax for orders 1-800-511-3654Custom DNA (right)

Version française ici

Real-Time PCR Probes, qPCR probes, TaqMan Probes, dual-label probes

For detailed description of the Real-Time PCR also known as qPCR, please click here (you will be redirected to Wikipedia); for the theory on the TaqMan probes click here (also Wikipedia).  Both types of probes are in fact dual-label probes, whereby the 5'-end is labeled with a reporter dye (such as FAM or Cy5) while the 3'-end is labeled with a quencher (such as the BHQ, MDQ, or TAMRA).

At Alpha ADN, we offer a large number of original and/or replacement reporter dyes, as shown in the table below.  We also offer three types of quenchers: (1) TAMRA as a quencher for FAM. (2) The Black Hole Quenchers (from LGC Biosearch Technologies) or shortly BHQ-1, BHQ-2 and BHQ-3 as quenchers for most dyes used in Real-Time PCR.  (3) MGB (minor groove binder, also known as MGB-NFQ, as it is a non-fluorescent quencher) as quenchers for most dyes used in Real-Time PCR (qPCR).

The table below is not exhaustive, if you do not see the reporter-quencher combination that you are interested in, please inquire with us. 

Please note that some of the reporter dyes in the dual-label probes are priced differently from the same dyes when used in single-label probes.  In a single-label probe, the reporter dye is usually coupled to the 5'-end of the oligonucleotide/probe (similarly to the dual-label probes) but the 3'-end lacks a quencher. The synthesis of the single-label probes can be done in two steps: (a) the DNA part of the oligo is always synthesized on the machine (the DNA synthesizer), but then (b) the reporter dye (a.k.a. the fluorophore, or simply the dye) can be added post-synthetically, after the cleavage of the oligo from the solid support.  This type of modification allows the use of less expensive reagents.  This is the reason why our prices for most fluorescent dyes are quite low, if you look at the Web page with the prices for the single-label dye modifications here.  By contrast, the synthesis of the dual-label probes does not allow the 5'-end reporter dye to be added post-synthetically, for the dual label (reporter-quencher) probes, the 5'-end dye MUST be added on the machine (the DNA synthesizer), which limits our choice of reagents; we are obliged to use more expensive reagents, and as a result, some of the reporter dyes, within the context of a dual-label probe, may cost significantly more than the same reporter dyes in the context of a single-label probe.


Pricelist for some of the available Real-Time PCR / qPCR / TaqMan / dual-label probes

All probes below have the following structure:  "Reporter Dye 5'-your_oligo_sequence_here-3' Quencher".  For reporter dyes and quenchers not on the list, please inquire by e-mail to

Fluorescein---BHQ1, 100 nmol scale

Fluorescein---BHQ1, 200 nmol scale

Fluorescein---BHQ1, 1000 nmol scale

Fluorescein---TAMRA, 100 nmol scale

Fluorescein---TAMRA, 200 nmol scale

Fluorescein---TAMRA, 1000 nmol scale

6-FAM---BHQ1, 100 nmol scale

6-FAM---MGB, 100 nmol scale

6-FAM---BHQ1, 200 nmol scale

6-FAM---MGB, 200 nmol scale

6-FAM---BHQ1, 1000 nmol scale

6-FAM---MGB, 1000 nmol scale

HEX---BHQ1, 100 nmol scale

HEX---BHQ1, 200 nmol scale

HEX---BHQ1, 1000 nmol scale

TET---BHQ1, 100 nmol scale

TET---BHQ1, 200 nmol scale

TET---BHQ1, 1000 nmol scale

6-FAM---TAMRA, 100 nmol scale

6-FAM---TAMRA, 200 nmol scale

6-FAM---TAMRA, 1000 nmol scale

VIC-repl.---BHQ1, 100 nmol scale

VIC-repl.---BHQ1, 200 nmol scale

VIC-repl.---BHQ1, 1000 nmol scale

NED-repl.---BHQ2, 100 nmol scale
NED-repl.---BHQ2, 200 nmol scale
NED-repl.---BHQ2, 1000 nmol scale

PET-repl.---BHQ2, 100 nmol scale
PET-repl.---BHQ2, 200 nmol scale
PET-repl.---BHQ2, 1000 nmol scale

LIZ-repl.---BHQ2, 100 nmol scale
LIZ-repl.---BHQ2, 200 nmol scale
LIZ-repl.---BHQ2, 1000 nmol scale

ROX-repl.---BHQ2, 100 nmol scale
ROX-repl.---BHQ2, 200 nmol scale
ROX-repl.---BHQ2, 1000 nmol scale

Cy3---BHQ2, 100 nmol scale
Cy3---BHQ2, 200 nmol scale
Cy3---BHQ2, 1000 nmol scale
Cy3.5---BHQ2, 100 nmol scale
Cy3.5---BHQ2, 200 nmol scale
Cy3.5---BHQ2, 1000 nmol scale

Cy5---BHQ2, 100 nmol scale
Cy5---BHQ2, 200 nmol scale
Cy5---BHQ2, 1000 nmol scale

Cy5.5---BHQ1, 100 nmol scale
Cy5.5---BHQ1, 200 nmol scale
Cy5.5---BHQ1, 1000 nmol scale

TAMRA---BHQ2, 100 nmol scale
TAMRA---BHQ2, 200 nmol scale
TAMRA---BHQ2, 1000 nmol scale

Texas Red-repl.---BHQ2, 100 nmol scale
Texas Red-repl.---BHQ2, 200 nmol scale
Texas Red-repl.---BHQ2, 1000 nmol scale
D4-repl.---BHQ2, 100 nmol scale
D4-repl.---BHQ2, 200 nmol scale
D4-repl.---BHQ2, 1000 nmol scale

D3-repl.---BHQ3, 100 nmol scale
D3-repl.---BHQ3, 200 nmol scale
D3-repl.---BHQ3, 1000 nmol scale

IRD700-repl.---BHQ3, 100 nmol scale
IRD700-repl.---BHQ3, 200 nmol scale
IRD700-repl.---BHQ3, 1000 nmol scale

Quasar 705---BHQ3, 100 nmol scale
Quasar 705---BHQ3, 200 nmol scale
Quasar 705---BHQ3, 1000 nmol scale

Redmond Red---BHQ2, 100 nmol scale
Redmond Red---BHQ2, 200 nmol scale
Redmond Red---BHQ2, 1000 nmol scale
Yakima Yellow---BHQ1, 100 nmol scale
Yakima Yellow---BHQ1, 200 nmol scale
Yakima Yellow---BHQ1, 1000 nmol scale


Synthesis scale 5'-end reporter dye DNA part of the dual-label probe (DNA sequence); the 20-mer sequence below is only given as an example, the customer would have to replace it with his/her own sequence, and calculate the price accordingly 3'-end quencher Price calculation Price for the probe (desalted), in USD or CAD*
100 nmol fluorescein ACGTACGTACGTACGTACGT (to be replaced with your sequence) BHQ-1    
  24.00 20 x 0.29 = 5.80 50.00 24 + 5.80 + 50 79.80 $
200 nmol fluorescein ACGTACGTACGTACGTACGT (to be replaced with your sequence) BHQ-1    
  24.00 20 x 0.39 = 7.80 50.00 24 + 7.80 + 50 81.80 $
1000 nmol fluorescein ACGTACGTACGTACGTACGT (to be replaced with your sequence) BHQ-1    
  50.00 20 x 0.79 = 15.80 100.00 50 + 15.80 + 100 165.80 $
100 nmol fluorescein ACGTACGTACGTACGTACGT (to be replaced with your sequence) TAMRA    
  24.00 20 x 0.29 = 5.80 49.00 24 + 5.80 + 49 78.80 $
200 nmol fluorescein ACGTACGTACGTACGTACGT (to be replaced with your sequence) TAMRA    
  24.00 20 x 0.39 = 7.80 49.00 24 + 7.80 + 49 80.80 $
1000 nmol fluorescein ACGTACGTACGTACGTACGT (to be replaced with your sequence) TAMRA    
  50.00 20 x 0.79 = 15.80 149.00 50 + 15.80 + 149 214.80 $
100 nmol 6-FAM or HEX or TET ACGTACGTACGTACGTACGT (to be replaced with your sequence) BHQ-1    
  29.00 20 x 0.29 = 5.80 50.00 29 + 5.80 + 50 84.80 $
100 nmol 6-FAM or HEX or TET ACGTACGTACGTACGTACGT (to be replaced with your sequence) MGB    
  29.00 20 x 0.29 = 5.80 95.00 29 + 5.80 + 95 129.80 $
200 nmol 6-FAM or HEX or TET ACGTACGTACGTACGTACGT (to be replaced with your sequence) BHQ-1    
  29.00 20 x 0.39 = 7.80 50.00 29 + 7.80 + 50 86.80 $
200 nmol 6-FAM or HEX or TET ACGTACGTACGTACGTACGT (to be replaced with your sequence) MGB    
  29.00 20 x 0.39 = 7.80 95.00 29 + 5.80 + 95 131.80 $
1000 nmol 6-FAM or HEX or TET ACGTACGTACGTACGTACGT (to be replaced with your sequence) BHQ-1    
  75.00 20 x 0.79 = 15.80 100.00 75 + 15.80 + 100 190.80 $
1000 nmol 6-FAM or HEX or TET ACGTACGTACGTACGTACGT (to be replaced with your sequence) MGB    
  29.00 20 x 0.29 = 5.80 285.00 75 + 15.80 + 285 375.80 $
100 nmol 6-FAM ACGTACGTACGTACGTACGT (to be replaced with your sequence) TAMRA    
  29.00 20 x 0.29 = 5.80 49.00 29 + 5.80 + 49 83.80 $
200 nmol 6-FAM ACGTACGTACGTACGTACGT (to be replaced with your sequence) TAMRA    
  29.00 20 x 0.39 = 7.80 49.00 29 + 7.80 + 49 85.80 $
1000 nmol 6-FAM ACGTACGTACGTACGTACGT (to be replaced with your sequence) TAMRA    
  75.00 20 x 0.79 = 15.80 149.00 75 + 15.80 + 149 239.80 $
100 nmol VIC-replacement dye ACGTACGTACGTACGTACGT (to be replaced with your sequence) BHQ-1    
  29.00 20 x 0.29 = 5.80 50.00 29 + 5.80 + 50 84.80 $
200 nmol VIC-replacement dye ACGTACGTACGTACGTACGT (to be replaced with your sequence) BHQ-1    
  29.00 20 x 0.39 = 7.80 50.00 29 + 7.80 + 50 86.80 $
1000 nmol VIC-replacement dye ACGTACGTACGTACGTACGT (to be replaced with your sequence) BHQ-1    
  75.00 20 x 0.79 = 15.80 100.00 75 + 15.80 + 100 190.80 $
 100 nmol JOE-replacement dye ACGTACGTACGTACGTACGT (to be replaced with your sequence) BHQ-1    
  29.00 20 x 0.29 = 5.80 50.00 29 + 5.80 + 50 84.80 $
200 nmol JOE-replacement dye ACGTACGTACGTACGTACGT (to be replaced with your sequence) BHQ-1    
  29.00 20 x 0.39 = 7.80 50.00 29 + 7.80 + 50 86.80 $
1000 nmol JOE-replacement dye ACGTACGTACGTACGTACGT (to be replaced with your sequence) BHQ-1    
  75.00 20 x 0.79 = 15.80 100.00 75 + 15.80 + 100 190.80 $
 100 nmol NED-repl. dye ACGTACGTACGTACGTACGT (to be replaced with your sequence) BHQ-2    
  80.00 20 x 0.29 = 5.80 50.00 80 + 5.80 + 50 135.80 $
200 nmol NED-repl. dye ACGTACGTACGTACGTACGT (to be replaced with your sequence) BHQ-2    
  80.00 20 x 0.39 = 7.80 50.00 80 + 7.80 + 50 137.80 $
1000 nmol NED-repl. dye ACGTACGTACGTACGTACGT (to be replaced with your sequence) BHQ-2    
  240.00 20 x 0.79 = 15.80 100.00 240 + 15.80 + 100 355.80 $
 100 nmol PET-replacement dye ACGTACGTACGTACGTACGT (to be replaced with your sequence) BHQ-2    
  80.00 20 x 0.29 = 5.80 50.00 80 + 5.80 + 50 135.80 $
200 nmol PET-replacement dye ACGTACGTACGTACGTACGT (to be replaced with your sequence) BHQ-2    
  80.00 20 x 0.39 = 7.80 50.00 80 + 7.80 + 50 137.80 $
1000 nmol PET-replacement dye ACGTACGTACGTACGTACGT (to be replaced with your sequence) BHQ-2    
  240.00 20 x 0.79 = 15.80 100.00 240 + 15.80 + 100 355.80 $
 100 nmol LIZ-replacement dye ACGTACGTACGTACGTACGT (to be replaced with your sequence) BHQ-2    
  80.00 20 x 0.29 = 5.80 50.00 80 + 5.80 + 50 135.80 $
200 nmol LIZ-replacement dye ACGTACGTACGTACGTACGT (to be replaced with your sequence) BHQ-2    
  80.00 20 x 0.39 = 7.80 50.00 80 + 7.80 + 50 137.80 $
1000 nmol LIZ-replacement dye ACGTACGTACGTACGTACGT (to be replaced with your sequence) BHQ-2    
  240.00 20 x 0.79 = 15.80 100.00 240 + 15.80 + 100 355.80 $
100 nmol ROX-repl. dye ACGTACGTACGTACGTACGT (to be replaced with your sequence) BHQ-2    
  80.00 20 x 0.29 = 5.80 50.00 80 + 5.80 + 50 135.80 $
200 nmol ROX-repl. dye ACGTACGTACGTACGTACGT (to be replaced with your sequence) BHQ-2    
  80.00 20 x 0.39 = 7.80 50.00 80 + 7.80 + 50 137.80 $
 1000 nmol ROX-repl. dye ACGTACGTACGTACGTACGT (to be replaced with your sequence) BHQ-2    
  240.00 20 x 0.79 = 15.80 100.00 240 + 15.80 + 100 355.80 $
 100 nmol Cy3 dye ACGTACGTACGTACGTACGT (to be replaced with your sequence) BHQ-2    
  80.00 20 x 0.29 = 5.80 50.00 80 + 5.80 + 50 135.80 $
200 nmol Cy3 dye ACGTACGTACGTACGTACGT (to be replaced with your sequence) BHQ-2    
  80.00 20 x 0.39 = 7.80 50.00 80 + 7.80 + 50 137.80 $
1000 nmol Cy3 dye ACGTACGTACGTACGTACGT (to be replaced with your sequence) BHQ-2    
  240.00 20 x 0.79 = 15.80 100.00 240 + 15.80 + 100 355.80 $
 100 nmol Cy5 dye ACGTACGTACGTACGTACGT (to be replaced with your sequence) BHQ-2    
  80.00 20 x 0.29 = 5.80 50.00 80 + 5.80 + 50 135.80 $
200 nmol Cy5 dye ACGTACGTACGTACGTACGT (to be replaced with your sequence) BHQ-2    
  80.00 20 x 0.39 = 7.80 50.00 80 + 7.80 + 50 137.80 $
1000 nmol Cy5 dye ACGTACGTACGTACGTACGT (to be replaced with your sequence) BHQ-2    
  240.00 20 x 0.79 = 15.80 100.00 240 + 15.80 + 100 355.80 $
100 nmol TAMRA dye ACGTACGTACGTACGTACGT (to be replaced with your sequence) BHQ-2    
  80.00 20 x 0.29 = 5.80 50.00 80 + 5.80 + 50 135.80 $
200 nmol TAMRA dye ACGTACGTACGTACGTACGT (to be replaced with your sequence) BHQ-2    
  80.00 20 x 0.39 = 7.80 50.00 80 + 7.80 + 50 137.80 $
1000 nmol TAMRA dye ACGTACGTACGTACGTACGT (to be replaced with your sequence) BHQ-2    
  240.00 20 x 0.79 = 15.80 100.00 240 + 15.80 + 100 355.80 $
 100 nmol Texas Red-repl. dye ACGTACGTACGTACGTACGT (to be replaced with your sequence) BHQ-2    
  80.00 20 x 0.29 = 5.80 50.00 80 + 5.80 + 50 135.80 $
 200 nmol Texas Red-repl. dye ACGTACGTACGTACGTACGT (to be replaced with your sequence) BHQ-2    
  80.00 20 x 0.39 = 7.80 50.00 80 + 7.80 + 50 137.80 $
1000 nmol Texas Red-repl. dye ACGTACGTACGTACGTACGT (to be replaced with your sequence) BHQ-2    
  240.00 20 x 0.79 = 15.80 100.00 240 + 15.80 + 100 355.80 $
 100 nmol D4-replacement dye ACGTACGTACGTACGTACGT (to be replaced with your sequence) BHQ-2    
  80.00 20 x 0.29 = 5.80 50.00 80 + 5.80 + 50 135.80 $
200 nmol D4-replacement dye ACGTACGTACGTACGTACGT (to be replaced with your sequence) BHQ-2    
  80.00 20 x 0.39 = 7.80 50.00 80 + 7.80 + 50 137.80 $
1000 nmol D4-replacement dye ACGTACGTACGTACGTACGT (to be replaced with your sequence) BHQ-2    
  240.00 20 x 0.79 = 15.80 100.00 240 + 15.80 + 100 355.80 $
 100 nmol D3-replacement dye ACGTACGTACGTACGTACGT (to be replaced with your sequence) BHQ-3    
  210.00 20 x 0.29 = 5.80 50.00 210 + 5.80 + 50 265.80 $
200 nmol D3-replacement dye ACGTACGTACGTACGTACGT (to be replaced with your sequence) BHQ-3    
  210.00 20 x 0.39 = 7.80 50.00 210 + 7.80 + 50 267.80 $
 1000 nmol D3-replacement dye ACGTACGTACGTACGTACGT (to be replaced with your sequence) BHQ-3    
  340.00 20 x 0.79 = 15.80 100.00 340 + 15.80 + 100 455.80 $
 100 nmol Cy5.5 dye ACGTACGTACGTACGTACGT (to be replaced with your sequence) BHQ-3    
  210.00 20 x 0.29 = 5.80 50.00 210 + 5.80 + 50 265.80 $
200 nmol Cy5.5 dye ACGTACGTACGTACGTACGT (to be replaced with your sequence) BHQ-3    
  210.00 20 x 0.39 = 7.80 50.00 210 + 7.80 + 50 267.80 $
1000 nmol Cy5.5 dye ACGTACGTACGTACGTACGT (to be replaced with your sequence) BHQ-3    
  340.00 20 x 0.79 = 15.80 100.00 340 + 15.80 + 100 455.80 $
 100 nmol IRD700-repl. dye ACGTACGTACGTACGTACGT (to be replaced with your sequence) BHQ-3    
  210.00 20 x 0.29 = 5.80 50.00 210 + 5.80 + 50 265.80 $
200 nmol IRD700-repl. dye ACGTACGTACGTACGTACGT (to be replaced with your sequence) BHQ-3    
  210.00 20 x 0.39 = 7.80 50.00 210 + 7.80 + 50 267.80 $
1000 nmol IRD700-repl. dye ACGTACGTACGTACGTACGT (to be replaced with your sequence) BHQ-3    
  340.00 20 x 0.79 = 15.80 100.00 340 + 15.80 + 100 455.80 $
100 nmol Quasar 705 dye ACGTACGTACGTACGTACGT (to be replaced with your sequence) BHQ-3    
  210.00 20 x 0.29 = 5.80 50.00 210 + 5.80 + 50 265.80 $
200 nmol Quasar 705 dye ACGTACGTACGTACGTACGT (to be replaced with your sequence) BHQ-3    
  210.00 20 x 0.39 = 7.80 50.00 210 + 7.80 + 50 267.80 $
1000 nmol Quasar 705 dye ACGTACGTACGTACGTACGT (to be replaced with your sequence) BHQ-3    
  340.00 20 x 0.79 = 15.80 100.00 340 + 15.80 + 100 455.80 $
100 nmol Cy3.5 dye ACGTACGTACGTACGTACGT (to be replaced with your sequence) BHQ-2    
  210.00 20 x 0.29 = 5.80 50.00 210 + 5.80 + 50 265.80 $
200 nmol Cy3.5 dye ACGTACGTACGTACGTACGT (to be replaced with your sequence) BHQ-2    
  210.00 20 x 0.39 = 7.80 50.00 210 + 7.80 + 50 267.80 $
1000 nmol Cy3.5 dye ACGTACGTACGTACGTACGT (to be replaced with your sequence) BHQ-2    
  340.00 20 x 0.79 = 15.80 100.00 340 + 15.80 + 100 455.80 $
 100 nmol Redmond Red dye ACGTACGTACGTACGTACGT (to be replaced with your sequence) BHQ-2    
  210.00 20 x 0.29 = 5.80 50.00 210 + 5.80 + 50 265.80 $
200 nmol Redmond Red dye ACGTACGTACGTACGTACGT (to be replaced with your sequence) BHQ-2    
  210.00 20 x 0.39 = 7.80 50.00 210 + 7.80 + 50 267.80 $
1000 nmol Redmond Red dye ACGTACGTACGTACGTACGT (to be replaced with your sequence) BHQ-2    
  340.00 20 x 0.79 = 15.80 100.00 340 + 15.80 + 100 455.80 $
 100 nmol Yakima Yellow dye ACGTACGTACGTACGTACGT (to be replaced with your sequence) BHQ-1    
  210.00 20 x 0.29 = 5.80 50.00 210 + 5.80 + 50 265.80 $
200 nmol Yakima Yellow dye ACGTACGTACGTACGTACGT (to be replaced with your sequence) BHQ-1    
  210.00 20 x 0.39 = 7.80 50.00 210 + 7.80 + 50 267.80 $
1000 nmol Yakima Yellow dye ACGTACGTACGTACGTACGT (to be replaced with your sequence) BHQ-1    
  340.00 20 x 0.79 = 15.80 100.00 340 + 15.80 + 100 455.80 $

*The above dollar prices are U.S. dollars for customers outside of Canada; the dollar values are in Canadian dollars only for customers from Canada, and are subject to government sales taxes (GST, HST, QST).  The taxes are extra (not included in the above prices).  The above prices are for desalted oligos, i.e. without additional purification, which is usually sufficient for most needs, if the probes are shorter than 30 bases.  We also offer additional purification by OPC or HPLC, which would cost extra (but is small, compared to the overall price for the probe), please inquire by e-mail to

To Alpha ADN address, fax and E-mail contact infoTo Alpha ADN Home PageTo Alpha ADN Products and PricesTo Alpha ADN Useful Info

© 1997-2019  Alpha ADN